Transcription and Translation

Spread the love

Quiz Forthcoming
  1. TRANSCRIPTION AND TRANSLATION By Mrs. Megan Jandy (Biology Educator)
  2. 2. DNA  ???  Now that you know about DNA, its replication, and that it is your genetic code HOW does you body use/read this DNA in order to make you? How does this… ATGGCCATACCCGGATACGCCATCA… TACCGGTATGGGCCTATGCGGTAGT… … Turn into you?
  3. 3. FIRST: DNA AND RNA; WHAT’S THE DIFFERENCE?  U is Uracil!
  4. 4. TYPES OF RNA  There are 3 types of RNA you need to know about  1) mRNA (messenger RNA)  sends a message outside of the nucleus to the ribosome (remember those? They make protein!)  2) rRNA (ribosomal RNA)  makes up the ribosome  3) tRNA (transfer RNA)  transfers amino acids building blocks of protein to the ribosome
  5. 5. STOP, PAUSE, AND TAKE NOTES!  What are the major differences between DNA and RNA?  What are the three types of RNA? What do they do?
  6. 6. STOP, PAUSE, AND TAKE NOTES!  What are the major differences between DNA and RNA?  RNA contains ribose sugar, is single stranded, can travel out of the nucleus, and uses Uracil instead of Thymine (U binds with A)  What are the three types of RNA? What do they do?  mRNA sends message outside of the nucleus  rRNA makes up ribosome  tRNA transfers amino acids to ribosome
  7. 7. SO WHAT DOES RNA HAVE TO DO WITH ANYTHING?  When it is time to transcribe a gene (express that gene) RNA Polymerase separates the DNA strands and adds complimentary mRNA bases to DNA  Remember, RNA uses Uracil instead of Thymine!
  8. 8. TRY TO WRITE THE MRNA CODE! DNA- ATCAGGACTA mRNA- UAGUCCUGAU This DNA gene is turned into an mRNA strand that codes for how to make a protein!  A gene is just a small portion of DNA (like a sentence in a book)
  9. 9. TRANSCRIPTION  Making mRNA from DNA is called Transcription!  We can remember that this happens first because transCription has a C and transLation has an L  C comes before L in the alphabet!
  10. 10. STOP, PAUSE, AND TAKE NOTES!  What is transcription?  What enzymes are involved in transcription?
  11. 11. STOP, PAUSE, AND TAKE NOTES!  What is transcription?  Transcription is when DNA is used to make single stranded mRNA  What enzyme is involved in transcription?  RNA polymerase- adds complimentary bases to DNA to form mRNA
  12. 12. OK… SO NOW WHAT?  The mRNA strand is now able to travel outside the nucleus to the ribosome! (also made of RNA)  The ribosome acts like a translator and translates the RNA language into protein language! Ribosome! …Unimpresed
  13. 13. TRANSLATION  mRNA is fed through a hole in the ribosome  The ribosome “reads” the mRNA strand  The ribosome can only read 3 bases at a time  Like reading one word at a time in a sentence  These 3 bases are called a CODON. mRNA sequence: AUGUGGCGAAAG 1 2 3 4 codons!
  14. 14. TRANSLATION  When the ribosome “reads” these codons it translates the mRNA language into protein language by attracting tRNA (transfer RNA) -Remember, tRNA transfers amino acids to the ribosomes  tRNA binds to the mRNA with a complimentary strand of RNA (called anti-codon)  Every codon codes for 1 amino acid!  Amino acids are the monomers of protein  20 different amino acids  Use codon table to determine amino acid translation
  15. 15. Ribosome mRNA tRNA Amino acid
  16. 16. CODON TABLE- WHAT AMINO ACID DOES AAG CODE FOR? Lysine!!!!
  17. 17. STOP, PAUSE, AND TAKE NOTES  When mRNA leaves the nucleus, where does it go?  What language does the ribosome translate? (what  what?)  What is a codon?  How does tRNA read a codon?
  18. 18. STOP, PAUSE, AND TAKE NOTES  When mRNA leaves the nucleus, where does it go?  mRNA leaves the nucleus and moves to a ribosome  What language does the ribosome translate? (what  what?)  The ribosome helps to translate mRNA language to protein language  What is a codon?  A codon is 3 mRNA bases  How does tRNA read a codon?  tRNA reads the codon which translates to 1 amino acid
  19. 19. ONE AMINO ACID DOES NOT A PROTEIN MAKE…  So now there is one amino acid at the ribosome… but a protein is made up of THOUSANDS of amino acids!  The ribosome then reads the next codon, which attracts a NEW tRNA and its amino acid.  It joins the 1st and 2nd amino acid together with a peptide bond.
  20. 20. AND ON, AND ON, AND ON  The ribosome continues to read the mRNA and attract complimentary tRNA to create a growing polypeptide chain  One the mRNA has been completely read and a polypeptide has been translated the mRNA and polypeptide leave the ribosome  The polypeptide then folds up on itself and the protein is then complete!
  21. 21. TRANSCRIPTION/TRANSLATION ANIMATION  http://www.wiley.com/college/test/0471787159/biolo gy_basics/animations/fromGeneToProtein.swf  Play only “types of RNA” “RNA processing” “transcription” and “translation”
  22. 22. STOP, PAUSE, TAKE NOTES  What is the bond between amino acids called?  Summarize what you have learned today!
  23. 23. STOP, PAUSE, TAKE NOTES  What is the bond between amino acids called?  The bonds between amino acids are called peptide bonds  Summarize what you have learned today! 1) Transcription takes place in the nucleus where the DNA code is used to make single stranded mRNA 2) mRNA moves out of the nucleus and into the cytoplasm where it binds to the ribosome 3) The ribosome reads the mRNA sequence one codon at a time and attracts tRNA with complimentary bases on one side and an amino acid on the other 4) mRNA is fed through the ribosome and additional tRNA add to the growing polypeptide chain
(Visited 314 times, 1 visits today)